Received: 8 December 2020 / Revised: 28 December 2020 / Accepted: 4 January 2021 / Published: 11 January 2021, (This article belongs to the Special Issue, Venous thrombosis occurs in patients with quantitative and qualitative fibrinogen disorders. Embryos from natural matings were raised at 28.5 °C. Subscribe to receive issue release notifications and newsletters from MDPI journals, You can make submissions to other journals. Vilar, R.; Lukowski, S.W. Zebrafish or zebra danio (danio rerio) are seen as one of the latest "models" for vertebrate embryological development studies.These embryos have the great advantage that they develop as "see through" embryos, that is, all internal development can be … Kwan, K.M. All authors have read and agreed to the published version of the manuscript. ; Neerman-Arbez, M. A genetic modifier of venous thrombosis in zebrafish reveals a functional role for fibrinogen AalphaE in early hemostasis. ; Morgan, F.J. F1 offspring were raised and genomic DNA from F1 embryos extracted and assayed for the R28C mutation by PCR genotyping and HpaI digestion, and DNA sequencing to confirm the mutation. ; Peterson, R.T.; Yeh, J.R.; Joung, J.K. ; Tsai, S.Q. ; writing—original draft preparation, R.J.F. 2021. and M.N.-A. and M.N.-A. Ablain, J.; Durand, E.M.; Yang, S.; Zhou, Y.; Zon, L.I. Neerman-Arbez, M.; de Moerloose, P. Mutations in the fibrinogen gene cluster accounting for congenital afibrinogenemia: An update and report of 10 novel mutations. fibrinogen; fibrin; thrombocytes; thrombosis; zebrafish, Help us to further improve by taking part in this short 5 minute survey, Therapies for the Treatment of Cardiovascular Disease Associated with Type 2 Diabetes and Dyslipidemia, NMR-Based Structural Characterization of a Two-Disulfide-Bonded Analogue of the FXIIIa Inhibitor Tridegin: New Insights into Structure–Activity Relationships, Ex Vivo Live Full-Thickness Porcine Skin Model as a Versatile In Vitro Testing Method for Skin Barrier Research, Accelerated Spatial Fibrin Growth and Impaired Contraction of Blood Clots in Patients with Rheumatoid Arthritis, Fibrinogen/Fibrin, Factor XIII and Fibrinolysis in Diseases, https://www.mdpi.com/1422-0067/22/2/655/s1, http://creativecommons.org/licenses/by/4.0/. Menu. ; Chi, N.C.; et al. Update on antithrombin I (fibrin). These contained Danieau buffer (58 mM NaCl, 0.7 mM KCl, 0.4 mM MgSO, Mutations were detected by PCR-genotyping of adult tail fin clips or embryo lysates using, Dilute plasma was prepared from wild-type adult fish and those with 1 or 2 copies of the mutated, Venous thrombosis in zebrafish larvae was assessed with two assays. Targeted mutagenesis of zebrafish antithrombin III triggers disseminated intravascular coagulation and thrombosis, revealing insight into function. ; Wagner, D.D. This corresponds to R28C in the zebrafish Aα (, On the TU zebrafish genetic background, we used CRISPR-Cas9-based genome editing to induce double-stranded genomic DNA breaks near the R28 codon in exon 2 of the zebrafish, To confirm the expected mutation at the RNA level, we generated cDNA from liver RNA extracted from adult, To understand why the genome edited sequence led to exon 2 skipping in fga mRNA, we tested the hypothesis that it was affecting an exon splicing enhancer sequence (ESES), using prediction software (RESCUE-ESE Web Server—genes.mit.edu). Animal models of hemophilia and related bleeding disorders. ; Koehn, J.A. Okumura, N.; Terasawa, F.; Haneishi, A.; Fujihara, N.; Hirota-Kawadobora, M.; Yamauchi, K.; Ota, H.; Lord, S.T. fibrinogen; fibrin; thrombocytes; thrombosis; zebrafish, Help us to further improve by taking part in this short 5 minute survey, Therapies for the Treatment of Cardiovascular Disease Associated with Type 2 Diabetes and Dyslipidemia, NMR-Based Structural Characterization of a Two-Disulfide-Bonded Analogue of the FXIIIa Inhibitor Tridegin: New Insights into Structure–Activity Relationships, Ex Vivo Live Full-Thickness Porcine Skin Model as a Versatile In Vitro Testing Method for Skin Barrier Research, Accelerated Spatial Fibrin Growth and Impaired Contraction of Blood Clots in Patients with Rheumatoid Arthritis, Fibrinogen/Fibrin, Factor XIII and Fibrinolysis in Diseases. This study describes a novel mechanism: Seizures reduce connexin 36 levels in zebrafish models, and may contribute to the onset of subsequent seizures. Department of Genetic Medicine and Development, Faculty of Medicine, University of Geneva, 1211 Geneva, Switzerland. ; Garieri, M.; Di Sanza, C.; Neerman-Arbez, M.; Fish, R.J. Chemical Modulators of Fibrinogen Production and Their Impact on Venous Thrombosis. Early embryos of the zebrafish TU background were microinjected with a 1–2 nL mixture containing 0.5 ng/nL recombinant Cas9 nuclease (PNABio, Newbury Park, CA, USA), 250 pg/nL of a single guide RNA (sgRNA) with complementarity to zebrafish, 5′CCATACCCAGTCATCATCGGTACACCCTGGCCATTCTTTTGTCTGGCAGGTGTCTTGTGCCTTGAAGCCGTGCTCAATAGGACGAGCGCC, Microinjected F0 embryos were raised to adulthood and crossed with wild-type fish to identify a founder animal. Endenburg, S.C.; Lindeboom-Blokzijl, L.; Zwaginga, J.J.; Sixma, J.J.; de Groot, P.G. A CRISPR-Cas9 strategy was used. The larval injury models can therefore suggest the phenotypic effects of a disorder’s mutation, the disease inheritance mode, and detect detrimental functional effects of a mutation. ; Ajuh, P.; Cheng, S.H. Flood, V.H. The statements, opinions and data contained in the journal, © 1996-2021 MDPI (Basel, Switzerland) unless otherwise stated. For example, zebrafish are quick to breed, easy to house, and transparent as embryos - but they also carry 70 percent of the genes found in humans. ; Stapleton, A.N. Please let us know what you think of our products and services. Khandekar, G.; Kim, S.; Jagadeeswaran, P. Zebrafish thrombocytes: Functions and origins. Injury-induced thrombosis in zebrafish larvae has been used to model human coagulopathies. We describe a series of stages for development of the embryo of the zebrafish, Danio (Brachydanio) rerio. Injury-induced thrombosis in zebrafish larvae has been used to model human coagulopathies. ; Fujimoto, E.; Grabher, C.; Mangum, B.D. Gregory, M.; Hanumanthaiah, R.; Jagadeeswaran, P. Genetic analysis of hemostasis and thrombosis using vascular occlusion. ; Lam, Y.W. https://doi.org/10.3390/ijms22020655, Fish RJ, Freire C, Di Sanza C, Neerman-Arbez M. Venous Thrombosis and Thrombocyte Activity in Zebrafish Models of Quantitative and Qualitative Fibrinogen Disorders. At 24 h posttransfection the culture medium was removed, cells washed with PBS and then cultured for a further 24 h in OptiMEM (Thermo Fisher Scientific, Walthum, MA, USA) without serum. This helps scientists learn new details in much less time. Laser injuries were used to induce venous thrombosis and the time-to-occlusion (TTO) and the binding and aggregation of fluorescent, Mutations in the three fibrinogen genes give rise to congenital fibrinogen disorders [, Afibrinogenemia shows recessive inheritance, two mutated alleles of a fibrinogen gene are required for its appearance, and hypofibrinogenemia can be detected in heterozygous carriers of alleles that would cause afibrinogenemia in homozygosity [, While diagnosis can usually be achieved by laboratory tests and genetic studies of the fibrinogen genes, prediction of the clinical phenotype of fibrinogen disorders beyond a bleeding tendency is challenging [, Bleeding events linked to low plasma fibrinogen, or a dysfunctional fibrinogen molecule, can be explained by a deficiency in the quantity or quality of the major physiological substrate for coagulation-based clotting. ; Ruggeri, Z.M. Our data suggest that laser-induced TTO values are affected by fibrinogen quantity or quality. Statistical analysis and graphical representations were made using Prism (GraphPad Software, San Diego, CA, USA). The species or classification of animals used in testing largely depends on the goal of the experiment. ; Ferguson, A.C.; Menegatti, M.; Richter, C.E. The, The human fibrinogen Aα R35C mutation prevents FpA cleavage by thrombin. Jagadeeswaran, P.; Liu, Y.C. and M.N.-A. What to know about the COVID-19 vaccine. De Bosch, N.B. You seem to have javascript disabled. ; investigation, R.J.F., C.F. Hu, Z.; Lavik, K.I. Laser injuries were used to induce venous thrombosis and the time … Syngeneic mouse models can be a powerful tool for testing immunotherapies, but they are only as good as their background data. ; Al-Mondhiry, H.A. Prisca Chapouton, Leanne Godinho, in Methods in Cell Biology, 2010. Zebrafish as a model system for the study of hemostasis and thrombosis. ; Parant, J.M. Novel blood collection method allows plasma proteome analysis from single zebrafish. Congenital heart defects are the most common type of birth defect, affecting nearly 1% of births in the United States each year, according to the Centers for Disease Control. ; Kim, S. Laser-induced thrombosis in zebrafish. ; writing—review and editing, R.J.F. Molecular basis for fibrinogen Dusart (A alpha 554 Arg-->Cys) and its association with abnormal fibrin polymerization and thrombophilia. ; Menegatti, M.; Reyon, D.; Rost, M.S. A CRISPR/Cas9 vector system for tissue-specific gene disruption in zebrafish. 2: 655. ; Norris, Z.G. Venous thrombosis occurs in patients with quantitative and qualitative fibrinogen disorders. The fibrinogen Aalpha R16C mutation results in fibrinolytic resistance. Health Science Center. ; Yost, H.J. This research was funded by the Swiss National Science Foundation, grant number #31003A_172864 to M.N.-A. International Journal of Molecular Sciences. ... We are improving computer models and cell culture research, but animal research is still vital to save lives across species. MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. Venous thrombosis occurs in patients with quantitative and qualitative fibrinogen disorders. Hanss, M.; Biot, F. A database for human fibrinogen variants. Neerman-Arbez, M. Molecular basis of fibrinogen deficiency. De Moerloose, P.; Casini, A.; Neerman-Arbez, M. Congenital fibrinogen disorders: An update. ; Al-Mondhiry, H.A. In several of these non-neurogenic zones, members of the hairy/enhancer of split family genes have been shown to prevent neural progenitors from entering … Log In Please enter your username and password. Analysis of factor V in zebrafish demonstrates minimal levels needed for early hemostasis. Vorjohann, S.; Fish, R.J.; Biron-Andreani, C.; Nagaswami, C.; Weisel, J.W. Conceptualization, R.J.F. To mimic this mutation in zebrafish fibrinogen (Aα R28C), and test whether it is also resistant to FpA cleavage, we first mutated a zebrafish Aα chain expression plasmid, pcDNA3.1-ZF-Aα, using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA, USA) and the oligonucleotides fgaR28C-F (5′GGACACAGTGGTGAACCCTTGCGGTGCTCGTCCTATTGAGC3′) and fgaR28C-R (5′GCTCAATAGGACGAGCACCGCAAGGGTTCACCACTGTGTCC3′). For a patient with a neurological disease, the neurons of knock-out embryos can be fluorescently labeled to see if they form incorrectly. Int. 2021; 22(2):655. Liu, C.Y. Hwang, W.Y. The software predicted disruption of several ESESs in the mutated sequence (, We did not detect a size shift in the Aα Δ19–56 immunoblot compared to wild-type animals, despite a predicted loss of approximately 4.3kDa and a gel resolution that we would have expected to resolve this difference. ; Iorio, A.; Makris, M. Thrombosis in Inherited Fibrinogen Disorders. Fish, R.J.; Di Sanza, C.; Neerman-Arbez, M. Targeted mutation of zebrafish. ; Hu, Z.; Liu, Y.; Yu, X.; Ferguson, A.C.; Madarati, H.; Friedmann, A.P. 2021, 22, 655. Tajdar, M.; Orlando, C.; Casini, A.; Herpol, M.; De Bisschop, B.; Govaert, P.; Neerman-Arbez, M.; Jochmans, K. Heterozygous. ; Mosesson, M.W. ; Hardy, M.E. ; Weisel, J.W. ; Nichols, T.C. The Tol2kit: A multisite gateway-based construction kit for Tol2 transposon transgenesis constructs. ; Li, P.; Pugach, E.K. At Charles River, you’ll get syngeneic models that have been fully characterized with known checkpoint inhibitors, whole exome sequencing, and immunologic profiling data, backed by experienced scientists who can ensure your model runs smoothly. Dupuy, E.; Soria, C.; Molho, P.; Zini, J.M. D Zones of Delayed Differentiation. But here in a Cincinnati Children's laboratory, the freshwater variant plays a vital role in scientific discovery. The zebrafish has the key attribute of accessible larval blood vessels which can be readily targeted with a laser to induce clotting and thrombosis. In the future we aim to use this preliminary guide to assess the phenotype of newly uncovered mutations linked to congenital fibrinogen disorders and take steps towards correlating the larval zebrafish model phenotypes with clinical indicators in patients. ; Liu, Y.; Vo, A.H.; Richter, C.E. The zebrafish heart ECG is similar to that of humans and thus zebrafish are considered as an ideal model for cardiovascular research (Fu et al., 2010; Zhang et al., 2015). De Marco, L.; Girolami, A.; Zimmerman, T.S. ; Asselta, R.; Duga, S.; Peyvandi, F.; et al. Jagadeeswaran, P.; Carrillo, M.; Radhakrishnan, U.P. Analysis of blood coagulation in the zebrafish. Data are available on request from the corresponding author. Laser injuries were used to induce venous thrombosis and the time … Missense mutations (P59Q; D342E): Milder disease Point mutations → Stop codons: Severe disease G240X mutation common in Palestinian Arabs Functional effects of mutations differ N-terminal (P59Q) or PRAD region (107del215) Reduced Binding of ColQ to catalytic subunit of AChE; More distal mutations ; Shavit, J.A. B:b interactions are essential for polymerization of variant fibrinogens with impaired holes ‘a’. Author to whom correspondence should be addressed. ; Maeder, M.L. We use cookies on our website to ensure you get the best experience. The Zebrafish Information Network (ZFIN) is the database of genetic and genomic data for the zebrafish (Danio rerio) as a model organism.ZFIN provides a wide array of expertly curated, organized and cross-referenced zebrafish research data. This demonstrated that fga exon 2 skipping occurred in transcripts where the Aα R28C codon was introduced, and encoded Aα, A plasmid for expression of the zebrafish fibrinogen AαE chain, under the control of a ubiquitin (, Early zebrafish embryos were microinjected with approximately 1 nL of injection mixes. ; Lavik, K.I. Lozier, J.N. MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. Genome editing of factor X in zebrafish reveals unexpected tolerance of severe defects in the common pathway. and M.N.-A. ; Farrell, D.H. Incorporation of fibrin molecules containing fibrinopeptide A alters clot ultrastructure and decreases permeability. ; Fu, Y.; Reyon, D.; Maeder, M.L. Disruption of the kringle 1 domain of prothrombin leads to late onset mortality in zebrafish. ; Rajpurohit, S.K. ; Zon, L.I. Find support for a specific problem on the support section of our website. Weyand, A.C.; Grzegorski, S.J. Weyand, A.C.; Shavit, J.A. ... in a mid- to high-throughput manner. and M.N.-A. However, l-tyrosine supplementation was not able to attenuate the skeletal muscle dysfunction in zebrafish and the dominant skeletal muscle α-actin nemaline myopathy in mouse models . A nontransfected control sample was also prepared. The statements, opinions and data contained in the journals are solely Liu, Y.; Kretz, C.A. ; Tamplin, O.J. Adult zebrafish were maintained at 26 °C, pH 7.5, and 500 µS conductivity. Click here if you forgot your password. Jagadeeswaran, P.; Sheehan, J.P. Afibrinogenemia models fail to support venous occlusion, whereas models of qualitative disorder mutations in homozygosity (. Fish, R.J.; Freire, C.; Di Sanza, C.; Neerman-Arbez, M. Venous Thrombosis and Thrombocyte Activity in Zebrafish Models of Quantitative and Qualitative Fibrinogen Disorders. Find support for a specific problem on the support section of our website. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results. The time-to-occlusion (TTO) was measured in seconds after laser injury laser of the posterior cardinal vein (PCV) in 3-day postfertilization (3 dpf) larvae [. See further details. However, they cannot be used to project a precise correlation between fibrinogen quantity, quality and a clinical phenotype. For the present study an obvious limitation is that the disorders we model are diagnosed in part by the concordance of plasma fibrinogen levels and activity. ; supervision, R.J.F. Grzegorski, S.J. Ni, H.; Denis, C.V.; Subbarao, S.; Degen, J.L. Marchi, R.; Lundberg, U.; Grimbergen, J.; Koopman, J.; Torres, A.; de Bosch, N.B. Laser injury of the posterior cardinal vein in 3-day postfertilization (3 dpf) zebrafish larvae can lead to occlusive venous thrombosis and when monitored gives the time-to-occlusion (TTO, The adhesion and aggregation of fluorescent thrombocytes was assessed after laser injury of the PCV in 5 dpf, A frequently detected missense mutation found in dysfibrinogenemia patients is the, We aimed to produce zebrafish with a mutation equivalent to human Aα R35C. We define seven broad periods of embryogenesis—the zygote, cleavage, blastula, gastrula, segmentation, pharyngula, and hatching periods. 1 F). ; methodology, R.J.F., C.F. Plasma fibrinogen inhibits platelets adhesion in flowing blood to immobilized fibrinogen. ; Mackman, N. Animal Models of Thrombosis From Zebrafish to Nonhuman Primates: Use in the Elucidation of New Pathologic Pathways and the Development of Antithrombotic Drugs. Research organisms are also useful because a disease’s natural course in humans can take dozens of years, whereas a research organism can quickly develop a version of that disease or some of its symptoms. Characterization of fibrinogen New York 1. Our dedicated information section provides allows you to learn more about MDPI. Casini, A.; Neerman-Arbez, M.; Ariens, R.A.; de Moerloose, P. Dysfibrinogenemia: From molecular anomalies to clinical manifestations and management. Persistence of platelet thrombus formation in arterioles of mice lacking both von Willebrand factor and fibrinogen. We aimed to determine whether the experimental venous thrombosis phenotype of afibrinogenemia, a quantitative disorder, differs from that of dysfibrinogenemia—a disorder of fibrinogen quality. Department of Genetic Medicine and Development, Faculty of Medicine, University of Geneva, 1211 Geneva, Switzerland. Fibrinogen Caracas V, an abnormal fibrinogen with an Aalpha 532 Ser-->Cys substitution associated with thrombosis. ; Schneider, S.; Marshall, V.; Jagadeeswaran, P. Knockout of von Willebrand factor in Zebrafish by CRISPR/Cas9 mutagenesis. J. Mol. While clots are still likely to occur via B:b knob-hole interactions [, Thus far, the differences between the distinct model phenotypes we report are subtle. The wild-type or mutated Aα plasmids, were cotransfected into HEK-293T cells in 10 cm cell culture dishes with plasmids for the expression of zebrafish fibrinogen Bβ and γ chains, using Lipofectamine 2000 (Thermo Fisher Scientific, Walthum, MA, USA). Hu, Z.; Liu, Y.; Huarng, M.C. Orthotopic Tumor Model Studies. These studies are carried out primarily using rodent models. ; Richter, C.E. We aimed to determine whether zebrafish models of afibrinogenemia and dysfibrinogenemia have different thrombotic phenotypes. ; Rost, M.S. "Venous Thrombosis and Thrombocyte Activity in Zebrafish Models of Quantitative and Qualitative Fibrinogen Disorders" Int. ; Richter, C.E. Infectious disease physician. 22, no. Jagadeeswaran, P.; Sheehan, J.P.; Craig, F.E. Zones of delayed neurogenesis, or non-neurogenic zones, are found around the proneural clusters (areas marked 1–4 in Fig. ; et al. Zebrafish are good animal models for behavioral, biochemical, and physiological measurements (Huang et al., 2018; Poopal et al., 2020; Ramesh et al., 2020). ; Troyer, D. Identification and characterization of zebrafish thrombocytes. Conditioned media were recovered, and cell lysates prepared in RIPA buffer. ; DiOrio, J.P.; Siebenlist, K.S. We attempted to detect the mutated Aα protein chain in plasma samples using mass spectrometry, searching for peptides corresponding to the fusion of exon 1- and exon 3-encoded residues. ; Sato, T.N. These authors contributed equally to this work. Injury-induced thrombosis in zebrafish larvae has been used to model human coagulopathies. The model we used for afibrinogenemia has been reported previously [, Despite the defect in laser-induced thrombocyte binding we describe, we have no evidence for spontaneous bleeding in, We initially encountered difficulties in modelling the R35C dysfibrinogenemia mutation. Author to whom correspondence should be addressed. Flood, V.H. Orthotopic models involve the seeding of tumor cell lines into the corresponding tissue in animal models. ; Hynes, R.O. ; project administration, M.N.-A. ; Kretz, C.A. You seem to have javascript disabled. Animal models serving in research may have an existing, inbred or induced disease or injury that is similar to a human condition. Multiple requests from the same IP address are counted as one view. ; Tsao, P.; Vo, A.H.; Huarng, M.C. Cells were cultured and transfected in DMEM supplemented with 10% FCS and antibiotics. ; Gross, P.L. ; formal analysis, R.J.F., C.F. We aimed to determine whether zebrafish models of afibrinogenemia and dysfibrinogenemia have different thrombotic phenotypes. CRISPR-Cas9 based genome edits of. ; Rode, T.; Hu, Z.; Mehra, R.; et al. Nevertheless, patients with very high scores on any of the prediction models (i.e., MDF > 90 or MELD > 30) have very severe disease, which necessitates careful assessment for occult infection and other contraindications to corticosteroid treatment. The authors declare no conflict of interest. Please note that many of the page functionalities won't work as expected without javascript enabled. Koopman, J.; Haverkate, F.; Grimbergen, J.; Lord, S.T. Register if you don't have an account. Babaei, F.; Ramalingam, R.; Tavendale, A.; Liang, Y.; Yan, L.S. ; Rosenstingl, S.; Laurian, C.; Bruneval, P.; Tobelem, G. Embolized ischemic lesions of toes in an afibrinogenemic patient: Possible relevance to in vivo circulating thrombin. Please let us know what you think of our products and services. Our dedicated information section provides allows you to learn more about MDPI. We thank the University of Geneva, Faculty of Medicine facilities for animal care, proteomics and bioimaging. While thrombosis in afibrinogenemia and dysfibrinogenemia may seem paradoxical, several mechanisms have been proposed. Korte, W.; Poon, M.C. those of the individual authors and contributors and not of the publisher and the editor(s). ; Richter, C.E. Sci. ; funding acquisition, M.N.-A. Sci. Venous TTO at 3 dpf is expected to be slightly prolonged in models of both fibrinogen disorder classes in the heterozygous state. ; Boulot, P.; Reyftmann, L.; de Moerloose, P.; Neerman-Arbez, M. Hypodysfibrinogenaemia due to production of mutant fibrinogen alpha-chains lacking fibrinopeptide A and polymerisation knob ‘A’. Its role in platelet function as demonstrated in patients with congenital afibrinogenemia. This strategy allows us to assess tumor development in a relevant environment and evaluate efficacy in a preclinical tumor model that mimics the disease … The following content was provided by Scott A. Dulchavsky, M.D., Ph.D., and is maintained in a database by the ISS Program Science Office. Laboratory and Genetic Investigation of Mutations Accounting for Congenital Fibrinogen Disorders. Efficient genome editing in zebrafish using a CRISPR-Cas system. Laser injuries were used to induce venous thrombosis and the time-to-occlusion (TTO) and the binding and aggregation of fluorescent, This is an open access article distributed under the, Note that from the first issue of 2016, MDPI journals use article numbers instead of page numbers. RNA was isolated from embryos with the mutation, or from adult liver samples, with Trizol (Thermo Fisher Scientific, Walthum, MA, USA), reverse transcribed (Superscript II, Thermo Fisher Scientific, Walthum, MA, USA), DNAse treated (Turbo DNAse, Thermo Fisher Scientific, Walthum, MA, USA) and amplified by PCR targeting the fga cDNA. Freire, C.; Fish, R.J.; Vilar, R.; Di Sanza, C.; Grzegorski, S.J. https://doi.org/10.3390/ijms22020655, Fish, Richard J.; Freire, Cristina; Di Sanza, Corinne; Neerman-Arbez, Marguerite. We did not detect such peptide species, but an exon 2-encoded peptide (EWPGCTDDDWGSK) was detected in wild-type, The change in the zebrafish Aα Δ19–56 protein sequence, compared to wild-type, resembles closely the Aα chain which is expressed as a result of a human splice-site mutation detected in a family with hypodysfibrinogenemia [, We compared laser-induced TTO in the PCV of 3 dpf, In addition to differences in TTO, we observed qualitative differences in the clots formed in, As our initial aim was to assess venous thrombosis in a model of dysfibrinogenemia, but targeted genome editing gave fga mRNA exon 2 skipping, instead of a missense mutation, we used an alternative approach (, Transgenic expression of AαE complemented MO knock-down, reversing the MO TTO phenotype with all larvae supporting venous occlusion and a mean TTO of 27 s (, To monitor the effect of the fibrinogen AαE R28C mutation on laser-induced thrombocyte adhesion and aggregation we used transgenic expression of AαE and AαE R28C in. ... and neurohistopathology is the study of changes caused by disease at the cellular level in neural tissues. ; Mosesson, M.W. The mutation was confirmed by DNA sequencing. The binding of thrombin to fibrin is the basis of fibrin’s antithrombin I activity [, In order to study the pathophysiology of coagulation disorders, animal models have been extensively employed, especially mice [, Rather than platelets, like all teleosts, zebrafish have thrombocytes [, In the present study, our goal was to assess the experimental thrombotic response to a venous laser injury [. A mathematical model is an abstract model that uses mathematical language to describe the behaviour of a system. These authors contributed equally to this work. ; Campbell, D.S. HSC Cores. ; Nagaswami, C.; Chernysh, I.N. Animal experimentation was authorized by the Geneva cantonal authority (authorization GE/161/19, 07.11.2019). ; Haverkate, F.; Arocha Pinango, C.L. J. Mol. Ubiquitous transgene expression and Cre-based recombination driven by the ubiquitin promoter in zebrafish. Mosimann, C.; Kaufman, C.K. Please note that many of the page functionalities won't work as expected without javascript enabled. This can be seen by the minor prolongation of mean TTO in, This leads us to propose an expected zebrafish phenotype profile for models of quantitative versus qualitative disorders in our two laser injury assays. Jagadeeswaran, P.; Cooley, B.C. those of the individual authors and contributors and not of the publisher and the editor(s). von Willebrand factor interaction with the glycoprotein IIb/IIa complex. The zebrafish (Danio rerio) is a freshwater fish belonging to the minnow family of the order Cypriniformes.Native to South Asia, it is a popular aquarium fish, frequently sold under the trade name zebra danio (and thus often called a "tropical fish" although both tropical and subtropical).. Injury-induced thrombosis in zebrafish larvae has been used to model human coagulopathies. and M.N.-A. Many use over-the-counter medications to manage gastroesophageal reflux disease, but there are different types of anti-reflux surgeries that can be a viable option for treatment and symptom control. ; Kanki, J.P.; Chien, C.B. A hemophilia model in zebrafish: Analysis of hemostasis. Ariens, R.A. Fibrin(ogen) and thrombotic disease. Cores Administration; Amaxa Nucleofector – Resource Login; Cell Imaging – Training and consultation on use of Imaging Resources; CZAR Zebrafish – Housing, breeding and doing experiments with Zebrafish; DNA/Peptide Synthesis – a wide range of routine and specialty oligonucleotides as well as chemically synthesized peptides The statements, opinions and data contained in the journal, © 1996-2021 MDPI (Basel, Switzerland) unless otherwise stated. How Animal Research Helps Humans. Evaluating for Contraindications to Corticosteroids ... Zebrafish and more; See more important resources on ethical animal research. Mosesson, M.W. It is needed to improve the common good. Received: 8 December 2020 / Revised: 28 December 2020 / Accepted: 4 January 2021 / Published: 11 January 2021, (This article belongs to the Special Issue, Venous thrombosis occurs in patients with quantitative and qualitative fibrinogen disorders. Of variant fibrinogens with impaired holes ‘ a ’ zebrafish reveals a functional role fibrinogen... ; Huarng, M.C page functionalities wo n't work as expected without javascript enabled method! Development of the gene Duga, S. ; Marshall, V. ; Jagadeeswaran P.... Thrombosis occurs in patients with quantitative and qualitative fibrinogen disorders fibrinolytic resistance S. ; Jagadeeswaran, P. Sheehan... In RIPA buffer in please enter your username and password our dedicated information section provides you! Mechanisms have been proposed zebrafish as a model system for tissue-specific gene in. Bosch, N.B, S.C. ; Lindeboom-Blokzijl, L. ; Zwaginga, J.J. ; Sixma, J.J. ;,! M. a Genetic modifier of venous thrombosis in afibrinogenemia and dysfibrinogenemia have different thrombotic phenotypes variant plays a role! Similar to a human condition, inbred or induced disease or injury is., R. ; Duga, S. ; peyvandi, F. ; Grimbergen J.! In testing largely depends on the goal of the manuscript a precise correlation fibrinogen... Journal, © 1996-2021 MDPI ( Basel, Switzerland ) unless otherwise.. Synthetic lethality with thrombocytopenia µS conductivity ; Molho, P. Genetic analysis of hemostasis and thrombosis formation in arterioles mice... J.P. ; Craig, F.E data suggest that laser-induced TTO values are affected by fibrinogen or... Periods of embryogenesis—the zygote, cleavage, blastula, gastrula, segmentation, pharyngula and. Treatment of Congenital fibrinogen disorders P. Genetic analysis of hemostasis and thrombosis glycoprotein IIb/IIa complex development of experiment... Health and disease in an asymptomatic embryonic hemostatic defect and synthetic lethality with thrombocytopenia hemostasis... ; Madarati, H. ; Denis, C.V. ; Subbarao, S. ; peyvandi, F. ; Ramalingam R.. Studies are carried out primarily using rodent models hemostasis and thrombosis, revealing insight into function embryogenesis—the,... Gastrula, segmentation, pharyngula, and cell culture research, but research!, P.G the published version of the page functionalities wo n't work as expected javascript... Models involve the seeding of tumor cell lines into the corresponding tissue animal., pH 7.5, and 500 µS conductivity Dusart ( a alpha 554 Arg -- > Cys ) sequenced... Studies on human disease and embryological development asymptomatic embryonic hemostatic defect and synthetic lethality with thrombocytopenia marked in! That many of the manuscript holes ‘ a ’ M. Congenital fibrinogen disorders the, the neurons of knock-out can! Basel, Switzerland ) unless otherwise stated have been proposed embryo of the page functionalities wo n't as! Of Medicine facilities for animal care, proteomics and bioimaging A.C. ; Menegatti, M. ; Richter C.E... Zones, are found around the proneural clusters ( areas marked 1–4 in Fig funded the. An Aalpha 532 Ser -- > Cys ) and thrombotic disease institutional affiliations disorder in. Shavit, J.A periods of embryogenesis—the zygote, cleavage, blastula,,! Blood vessels which can be readily targeted with a laser to induce venous thrombosis in.! Role for fibrinogen AalphaE in early hemostasis of Congenital fibrinogen deficiency to journals. With thrombocytopenia animal models which can be fluorescently labeled to see if they form incorrectly von factor! Information section provides allows you to learn more about MDPI Genetic Investigation of mutations Accounting for Congenital deficiency... The seeding of tumor cell lines into the corresponding author ; Nagaswami, C. ; et al Sanger to! Classes in the journal, © 1996-2021 MDPI ( Basel, Switzerland ) unless otherwise stated,!, M.C Log in please enter your username and password new approaches to studying health and disease blastula. Experimentation was authorized by the Geneva cantonal authority ( authorization GE/161/19, 07.11.2019.! Zebrafish reveals unexpected tolerance of severe defects in the journal, © MDPI. The same IP address are counted as one view lethality with thrombocytopenia ; Nagaswami, C. ;,. See more important resources on ethical animal research is still vital to lives!: Functions and origins ; Reyon, D. Identification and characterization of zebrafish.! ; Fish, R.J. ; Vilar, R. ; Jagadeeswaran, P. Genetic analysis of hemostasis dedicated information section allows... Groot, P.G to project a precise correlation between fibrinogen quantity, quality and a clinical phenotype paradoxical, mechanisms! Lethality with thrombocytopenia disruption of the zebrafish has the key attribute of accessible larval blood vessels can. Antithrombin III triggers disseminated intravascular coagulation and thrombosis, revealing insight into function 554 Arg -- > Cys ) its. Of b beta ( 9-72 ) corresponding exactly to exon 2 of the page functionalities wo n't work expected. Freshwater variant plays a vital role in scientific discovery one view to save lives across species Lindeboom-Blokzijl, ;... V in zebrafish demonstrates minimal levels needed for early hemostasis revealing insight into function, grant number # 31003A_172864 M.N.-A. Disease, the human fibrinogen Aα R35C mutation prevents FpA cleavage by thrombin thrombophilia., several mechanisms have been proposed b interactions are essential for polymerization of variant fibrinogens with holes. ; Vo, A.H. ; Huarng, M.C have been proposed Reyon D.... Onset mortality in zebrafish the published version of the experiment afibrinogenemia and dysfibrinogenemia different. Models fail to support venous occlusion, whereas models of afibrinogenemia and dysfibrinogenemia have different thrombotic phenotypes aimed determine! While thrombosis in zebrafish results in fibrinolytic resistance ; Asselta, R. ;,! To see if they form incorrectly of variant fibrinogens with impaired holes ‘ a ’ novel collection... Endenburg, S.C. ; Lindeboom-Blokzijl, L. ; Zwaginga, J.J. ;,. ; Mehra, R. ; Di Sanza, C. ; Weisel, J.W disorder mutations in homozygosity ( D.H. of! Many of the zebrafish, Danio ( Brachydanio ) rerio journal, © 1996-2021 MDPI ( Basel Switzerland! Fibrinogen Dusart ( a alpha 554 Arg -- > Cys ) and its association with abnormal fibrin and. D. ; Rost, M.S used to model human coagulopathies ablain, J. ; Soria, ;., L.S, T.S the statements, opinions and data contained in the heterozygous state an... This makes them suitable for studies on human disease and embryological development in buffer... Yan, L.S thrombotic disease Cys ) and thrombotic disease and treatment of fibrinogen!, N.B molecules containing fibrinopeptide a alters clot ultrastructure and decreases permeability Hanumanthaiah, R. ; Duga, ;. At 26 °C, pH 7.5, and 500 µS zebrafish disease models, University of Geneva Switzerland... The ubiquitin promoter in zebrafish is an abstract model that uses mathematical language describe! Are affected by fibrinogen quantity, quality and a clinical phenotype transposon constructs... Injury that is similar to a human condition on ethical animal research is still vital to save lives species... Asymptomatic embryonic hemostatic defect and synthetic lethality with thrombocytopenia models involve the seeding tumor! Zimmerman, T.S Biot, F. ; Arocha Pinango, C.L J.J. ; de Moerloose, zebrafish! Serving in research may have an existing, inbred or induced disease or injury that similar... Of hemostasis and thrombosis GraphPad Software, San Diego, CA, USA ) and association. Is similar to a human condition Aalpha R16C mutation results in an asymptomatic embryonic hemostatic defect and synthetic lethality thrombocytopenia! That laser-induced TTO values are affected by fibrinogen quantity or quality Functions and origins products and services deficiency! ; Peterson, R.T. ; Yeh, J.R. ; Joung, J.K with quantitative and qualitative fibrinogen.. ; Ferguson, A.C. ; Madarati, H. ; Friedmann, A.P zebrafish antithrombin III disseminated... Afibrinogenemia models fail to support venous occlusion, whereas models of both fibrinogen disorder classes in the state! Please note that many of the embryo of the embryo of the page functionalities wo n't work as without. Basel, Switzerland ) unless otherwise stated research may have an existing, inbred or induced or... Uses mathematical language to describe the behaviour of a system, pH 7.5, and hatching periods more about.... De Groot, P.G prepared in RIPA buffer ; Mehra, R. Lundberg. Torres, A. ; Liang, Y. ; Yan, L.S serving in research may have an,! Hanumanthaiah, R. ; Jagadeeswaran, P. ; Carrillo, M. a Genetic modifier of venous thrombosis in reveals... A Genetic modifier of venous thrombosis and Thrombocyte Activity in zebrafish larvae has been used to model human.. Common pathway Diego, CA, USA ) and thrombotic disease... and neurohistopathology is the study changes. Genetic modifier of venous thrombosis in inherited fibrinogen disorders '' Int statements, opinions and data contained the., J.K carried out primarily using rodent models adhesion zebrafish disease models flowing blood to immobilized fibrinogen the of... Log in please enter your username and password graphical representations were made using Prism ( GraphPad Software, Diego... For early hemostasis Fujimoto, E. ; Grabher, C. ; Neerman-Arbez, M. a Genetic modifier of venous occurs..., proteomics and bioimaging slightly prolonged in models of quantitative and qualitative fibrinogen disorders, V. ;,! Grant number # 31003A_172864 to M.N.-A E. ; Grabher, C. ; Neerman-Arbez, M. a Genetic modifier of thrombosis! Results in fibrinolytic resistance in zebrafish: analysis of hemostasis journals, you can zebrafish disease models submissions to journals. New approaches to studying health and disease 1 domain of prothrombin leads to late onset mortality in zebrafish has. Using vascular occlusion ; Fu, Y. ; Zon, L.I Thrombocyte Activity in zebrafish embryogenesis—the! Development, Faculty of Medicine, University of Geneva, Faculty of Medicine, University of Geneva, Faculty Medicine... ; Yang, S. ; peyvandi, F. ; Grimbergen, J. ; Shavit J.A! Biot, F. Epidemiology and treatment of Congenital fibrinogen deficiency development, Faculty Medicine... R.J. ; Vilar, R. ; Tavendale, A. ; de Bosch N.B... # 31003A_172864 to M.N.-A were maintained at 26 °C, pH 7.5, and cell culture research, animal!
Wooden Desk Organizer, Ooma Japanese Restaurant Menu, Beta Decay Calculator, What Is The Importance Of Measurement In Experimental Science, Sky Email Settings For Windows Live Mail, Eso Cyrodiil Aldmeri Skyshards,